Category: IGCSE Biology posts
Protein Synthesis (part 1): Grade 9 Understanding for IGCSE Biology 3.18B
This is by far the most difficult concept for you to understand in the new GCSE specifications. In fact, it was only ever taught to A level students until last year (and to be honest I would much prefer it that way!). But that is no consolation to you poor folk who are going to get tested on it in your IGCSE and GCSE exams…
I am going to keep this as simple as I possibly can but am not going to dumb it down…. My blog is aimed for students who are ambitious to develop Grade 9 understanding in Biology (this topic is not tested at all in our Double Award Science course) so I want to explain it to you at the level you need. But you will need to read this carefully, take your time and you might need to break it down into small sections to build the understanding you need.
Can I suggest that first of all you read this post from my blog about DNA and how it works?
What is a gene?
A gene is a section of DNA that codes for a single protein. How does this code work? Well the short answer is that the sequence (order) of the bases as you read along the DNA molecule is a code for the sequence of amino acids that are joined together to make the protein.
Remember that there are 4 different bases in DNA: Adenine (A), Thymine (T), Cytosine (C) and Guanine (G). So a sequence of bases on a piece of DNA might look like this:
GCCTATAAATGGCAGGCATTAGCTCTAGGAAATCTAGGGACTTTACA
Protein Synthesis
Proteins are made by joining small molecules called amino acids together. This process is called protein synthesis and happens in small structures in the cytoplasm of all cells called ribosomes. But for all eukaryote cells, this poses a big geographical problem.
The “information” in the gene is stored in a sequence of bases in a DNA molecule and is found in the nucleus. DNA never leaves the nucleus because it is too important a molecule to be allowed into the reactive and unpredictable environment in the cytoplasm. But there are no ribosomes in the nucleus and these are the structures in which proteins are actually made. So a temporary intermediate molecule is needed to carry the “information” from the gene in the nucleus out into the cytoplasm where the ribosomes are found. So the process of making a protein therefore has to exist as a two stage process. The first stage is making the temporary intermediate molecule using the sequence of bases in the gene. Then there is a second stage that happens in the cytoplasm in the ribosome and this involves joining the amino acids together to make the actual protein.
This idea was called the “central dogma of molecular biology” by Watson and Crick in their famous paper on the structure of DNA.
Transcription and Translation
There is quite a lot of jargon in this topic.
Transcription is the name for the process that happens in the nucleus in which a temporary intermediate molecule is made. This temporary “information-containing” molecule is a form of RNA called messenger RNA (or mRNA for short). The mRNA travels out of the nucleus to a ribosome which is found in the cytoplasm. Here a process called Translation occurs in which the the amino acids are joined together in the correct order to make the protein.
Look at this second diagram of the central dogma above. It shows a double-stranded DNA molecule at the top with pairs of bases (either A-T or C-G) joined by hydrogen bonds. The “information” in the molecule is found in the sequence of bases: on the top strand of the DNA this sequence is ATGATCTCGTAA.
You can see that transcription results in the formation of a molecule of mRNA. (Remember that RNA is always a single stranded molecule and contains the base Uracil in place of the base Thymine)
So can you see that the sequence of bases in the mRNA is almost identical to the DNA strand above, but with the base T replaced by the base U.
mRNA sequence: AUGAUCUCGUAA
This diagram shows us one final thing about how protein synthesis works. Look now at the small section of protein (polypeptide) that is produced in translation. You can see that this section of protein is made of three amino acids joined together: methionine (Met), attached to isoleucine (Ile) attached to serine (Ser)
Each amino acid is coded for by a group of 3 adjacent bases on the mRNA molecule. These triplets of bases are called Codons.
- AUG is a codon that codes for the amino acid Methionine
- AUC is a codon that codes for the amino acid Isoleucine
- UCG is a codon that codes for the amino acid Serine
(UAA is called a stop codon as it ends the translation process at the ribosome)
A codon is a triplet of adjacent bases on a mRNA molecule. Each codon codes for a single amino acid that will be joined together to make the protein.
Check your understanding:
Can you explain the meaning of the following terms? Write a 2 mark explanation of what each word means.
- Gene
- Ribosome
- Transcription
- Messenger RNA
- Translation
- Codon
I will put the answers into the next post called Protein Synthesis (part 2) which I promise I will write tomorrow…… That’s enough for now.
Stem Cells in Medicine: Grade 9 Understanding for IGCSE Biology 2.6B
In the previous post, I described what is meant by a stem cell and how stem cells are formed from the non-specialised cells of the embryo in a process called differentiation.
Stem cells have the potential to be used in a variety of medical treatments. At present, there are very few diseases for which stem cell treatments are available in the UK but the potential is certainly there for many more in the future.
What are the advantages of using stem cells in medicine?
Many diseases in the body are caused by certain groups of cells dying prematurely. For example Parkinson’s Disease is a brain disease where a small group of nerve cells in the substantia nigra of the brain die. Diseases like this are called degenerative diseases and some examples are shown in the diagram above. Stem cells allow the possibility of replacing the cells that have died with new cells derived the patient’s own stem cells. The big advantage of doing this (as opposed to replacing the lost cells with transplanted cells from another person) is that there should be no chance of the immune system rejecting the transplanted cells. If scientists could take some of the patient’s adult stem cells and treat them so they become specialised into new substantia nigra cells, these cells could be added into to the brain and the symptoms of the disease may be overcome. This offers a cure to some diseases that are currently very difficult to treat.
What are the disadvantages of using stem cells in medicine?
But……. the main problem is this. Adult stem cells (such as those found in the bone marrow) are multipotent. This means that they can only develop into a small number of cell types. To get pluripotent stem cells that can develop into almost all cell types, you need to get the stem cells from an embryo. These stem cells are much more useful for doctors and usually comes from “spare” embryos produced in IVF treatment for infertile couples. This leads to serious ethical implications as the early embryo of course cannot give informed consent to be used in this way! There are also practical difficulties. Stem cells have the potential to develop into tumours when put into the body and thus cause cancers. They may also provide a way for dangerous pathogens to get into the body. Embryonic stem cells may also be rejected by the patient’s own immune system and killed.
If you want to watch a summary video about stem cells, this is a good one in my opinion.
Cell Differentiation and Specialised Cells: Grade 9 Understanding for IGCSE Biology 2.5B
You will have learned at KS3 about the basic structure of a “typical” animal cell. But our bodies are not made of cells that look like this “typical” cell. Humans have just over 200 different types of cell, each specialised to carry out a particular function. For example red blood cells are specialised for transporting oxygen, muscle cells are specialised for movement and sperm cells are specialised as the male gamete for delivering a haploid nucleus to the egg cell.
The diagram above shows examples of a few types of specialised cells from the human body.
These specialised cells are produced in the process of cell division.
Cells that are not yet specialised but that retain the ability to develop into a variety of different cell types are called stem cells. Many cells in the embryo are stem cells (as they have not yet specialised into a particular cell type) but we also have a few stem cells in the adult (for example the cells in the bone marrow that can develop into all the different cell types in blood).
The process by which stem cells develop into specialised cells is called differentiation. Luckily you don’t need to understand exactly how this works but basic idea is this: differentiation involves certain genes in the nucleus being switched on and off so that a specialised cell only makes a certain set of proteins. Remember that a gene is a section of our DNA that codes for a single protein. Nerve cells make the proteins needed to send nerve impulses, white blood cells make the proteins needed to combat infections. You get the idea…..
Stem cells play an important role in medicine but that’s for another post……… If you want to read more about stem cells, this website is a good place to start.
Two days to go before the EdExcel IGCSE Biology paper 2
I’m writing this on Friday evening and the 2018 IGCSE Biology paper 2 is on Monday. So you are almost there…..
What can you do in the final two days?
- Look over the topics that can only appear in paper 2 and make sure you understand them as well as you can.
- Look at my post with some guesses as to what topics were not assessed on paper 1 and make sure you understand them as well as you can.
- One last work through those topics in the specification where you know your knowledge or understanding is not great (don’t waste time this weekend going over things you definitely already understand!)
- Rest properly, get two proper nights’ sleep so you are relaxed and ready to THINK in the exam on Monday. You will need some downtime this weekend to enjoy yourself and switch off thinking about exams…..
Good luck to you all! Your study of GCSE Biology is almost over… I will have my fingers crossed that the exam paper on Monday allows you to demonstrate the detailed knowledge and understanding you have built up
EdExcel IGSE Biology Paper 2B 2018 predictions
I hope readers of my blog felt that the Biology paper 1B went well earlier this week. For what it is worth, I thought it was a good but challenging paper but there is nothing at all on there that seemed unfair to me. I am confident that it gave students a good chance to show the understanding and knowledge you have built up over three years. But….. you still have 33% of your marks still available to you, so my thoughts have now turned to paper 2B in a few weeks time.
I have been through the paper 1B carefully to look at which subject areas have been tested in the questions. This might allow you to focus your revision now onto topic areas that have not yet come up. But the next point is very important: there is absolutely nothing that says they cannot ask questions on the some of the same topics inboth papers. Predicting exam questions is a dangerous game (!?!) and there is absolutely nothing in this blog post that should contradict the idea that you need to be fully clued up and ready for questions on every single specification point when you sit your paper 2B.
But there are some things we know about what is likely to appear in the paper 2B.
- Firstly there are some specification points in bold that cannot be assessed in paper 1 and can only appear in paper 2. I have a blog post that lists these so I won’t type them all out again. Have a look here to see a full list of the bullet points in bold….
- Listed below are some topic areas that were not tested at all in the summer 2018 paper 1B. I would anticipate that several of these will definitely appear in paper 2B so if I were in your position, these would be my top priorities for revision in the coming weeks:
Variety of Living organisms and 5 Kingdom Classification 1.2
Viruses 1.2
Movement of substances into and out of cells – Diffusion, Osmosis and Active Transport 2.12, 2.13, 2.14, 2.15, 2.16
Transport in Plants – Xylem and Phloem 2.51, 2.52, 2.53, 2.54, 2.55. 2.56
Heart Structure and Circulatory Systems 2.63, 2.64, 2.65, 2.66
Human Nervous Systems 2.83, 2.84, 2.85, 2.86,
The Eye 2.87, 2.88, 2.89,
Hormones 2.90
Reproduction in Flowering Plants 3.3, 3.4, 3.5, 3.6, 3.7
Reproduction in Humans 3.8, 3.9, 3.10, 3.11, 3.12
DNA and Genetics – this must come up!! 3.13, 3.14, 3.15, 3.16, 3.17, 3.18, 3.19, 3.20, 3.21, 3.22
Ecology – Food chains and Webs, quadrats etc. 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7
Carbon and Nitrogen Cycles 4.8, 4.9, 4.10
Selective Breeding 5.10, 5.11
Genetic Modification 5.12, 5.13, 5.14, 5.15, 5.16
Cloning 5.17, 5.18, 5.19, 5.20
The focus of your revision now should be looking at past papers and mark schemes. I know many of you have done this already for paper 1B.
If you want more past papers and mark schemes, I suggest you download them for free from this website: http://www.physicsandmathstutor.com/past-papers/gcse-biology/edexcel-igcse-paper-2/
Please remember there are posts on my website for every single specification point above. Just type in the specification code in the search box and it should (?!) take you straight to the relevant page. Please do ask me questions or leave comments at the bottom of any posts. It may take a while for them to be visible as I have to “approve” them to remove spam. You would be amazed at some of the stuff I seem to attract from the depths of the internet…..
Keep working hard and good luck!
Revision strategies for IGCSE Biologists
Holiday revision: some PMG tips for Y11 students to maximise the effectiveness of their work
The post above was written a couple of years ago for my Y11 students embarking on Easter revision. I know that some of my current 5th formers are working this week so I thought I would re-post it. Some things have changed since 2015 (notably the sad demise of Zondle) but the key principles remain…. I hope it helps!
GCSE Results Day 2017
I wish you all the best of luck on results day. Be pleased (but not too pleased) if you’ve done better than you expected and don’t be too disappointed if the reverse is true. GCSE grades are important in determining the next stages of your education but do remember that in 5 years time, no-one will ever again be interested in your news from today….
I think the most important thing to think about today is this. From around the beginning of April until the end of your final GCSE exam, you have been working independently, working things out for yourself, making notes and using web resources to improve your learning and understanding. You have decided what to study and how best to achieve your learning goals. And these are exactly the skills that will be needed to make a success of the next stage of your education! So the question is “can you keep up these high levels of motivation/determination/organisation when you start your A level courses in September?”
But I hope you will find time for some celebrations before the serious stuff starts again in September! Enjoy the rest of your summer.
IGCSE Biology 2017 paper 2 predictions
This post starts with a massive proviso of course. Making predictions as to which topics might appear in a future exam is a very risky business. The paper 2 you will all sit after half term can test material from the entire specification (including all the specification points in bold) and there is absolutely no guarantee that topics tested in paper 1 may not reappear in some form in paper 2.
So the proviso is this: the only way to be fully prepared for paper 2 is to revise the entire specification so that you are prepared for whatever the examiners might throw at you.
But having said that, it seems sensible to focus your revision for paper 2 onto topic areas that were not examined in paper 1. If I were in your position, these are the topic areas for which I would be doing most of my revision in the coming weeks:
- Respiration 2.33 – 2.37
- Gas exchange in Plants 2.38-2.43
- Transport in Plants 2.49 – 2.56
- Transport in Humans 2.57 – 2.66
- Kidney 2.68 – 2.76
- Reproduction 3.1 – 3.12
- Food Chains and Energy Flow 4.4 – 4.7
- Nitrogen and Water Cycles 4.8, 4.10
- Human Influences on Environment 4.11 – 4.17
- Food Production (including fish farming) 5.1 – 5.9
- Selective Breeding and Genetic Modification 5.10 – 5.16
The bad news is that this list above still forms a large proportion of the extensive EdExcel IGCSE Biology specification but the good news is that there are PMGBiology blog posts on all the above. So please use the search function on my homepage to find material to help you revise.
Practice papers and mark schemes are available online (and for my students on the school Firefly page)
Keep working hard – you are almost there and the summer to come will be long and restful….
Three days to go…..
For those students following the EdExcel IGCSE Biology course there are now just three days to go until the paper 1. This is the two hour exam covering all the specification (with the exception of the handful of content points in bold). If you started revision early enough, you should know be feeling confident that you have the knowledge and understanding needed for whatever challenge the examiner might throw at you. So how best to use your time in the final few days…? It is a tricky question as the answer will vary for different people – you must always do what you think is best for you and your chances.
But if it were me, I would be trying to do the following:
- Have a go at as many past paper questions as possible over the weekend. Answer the questions under exam conditions, then mark them yourselves using the mark schemes available online. Pay particular attention to marks lost due to poor reading/interpretation of the question or poor-exam technique.
- Prepare yourself for the questions that you “know” will come up on Tuesday. It is almost certain that there will be a genetics question to make sure you remember how to set out genetic crosses correctly. There is always a graph to plot and questions asking you to describe the pattern in a set of results. How can you ensure you always get full marks on these questions which require no biological understanding to answer?
- Look at the experimental design questions and continue to practise them. Check over all the required practicals mentioned in the specification and ensure you understand how they work.
Finally on Monday night, please get an early night so you are refreshed and ready for a 2 hour paper. There is no point doing hours and hours of last minute cramming as it simply doesn’t work. If the Biology exam were like a Spanish vocab test then I would encourage you to spend four hours before the paper going over and over the material….. But your exam is going to require you to interpret data, to make suggestions and come up with explanations for things you haven’t seen before. You cannot think clearly or concentrate fully on reading the question when you are exhausted. So if you decide to cram, the chances are that many more marks will be lost through tiredness than will be gained by any short-term memory gains.
Please go to bed at a normal time on Monday night and wake up at a normal time on Tuesday morning.
And the very best of luck to you all!
Banned Words in IGCSE Biology answers
There are one or two words which you should never use in your answers to IGCSE Biology papers.
- The boys I teach know that amount is a banned word. If you find yourself writing amount, please cross it out immediately and think which of the following terms is actually the word you should be using: concentration, volume, mass, number .
[Amount has a specific meaning in science: it means the number of moles of a substance and seeing as you don’t need to know about the dreaded mole for Biology, it should never be used.]
(this is a good photo of the dreaded mole)
- Be wary of using the word nutrient without giving an example of what molecule you mean. A nutrient is food molecule like glucose, amino acid or lipid. When you are describing the things in soil that are absorbed into the roots and are transported in xylem, it is better to refer to them as minerals.
- Level does not mean the same as concentration. Don’t write about the level of oxygen when you mean concentration.
PMG Biology 