This is by far the most difficult concept for you to understand in the new GCSE specifications. In fact, it was only ever taught to A level students until last year (and to be honest I would much prefer it that way!). But that is no consolation to you poor folk who are going to get tested on it in your IGCSE and GCSE exams…

I am going to keep this as simple as I possibly can but am not going to dumb it down…. My blog is aimed for students who are ambitious to develop Grade 9 understanding in Biology (this topic is not tested at all in our Double Award Science course) so I want to explain it to you at the level you need.  But you will need to read this carefully, take your time and you might need to break it down into small sections to build the understanding you need.

Can I suggest that first of all you read this post from my blog about DNA and how it works?

What is a gene?

A gene is a section of DNA that codes for a single protein.  How does this code work?  Well the short answer is that the sequence (order) of the bases as you read along the DNA molecule is a code for the sequence of amino acids that are joined together to make the protein.

Remember that there are 4 different bases in DNA: Adenine (A), Thymine (T), Cytosine (C) and Guanine (G).  So a sequence of bases on a piece of DNA might look like this:

GCCTATAAATGGCAGGCATTAGCTCTAGGAAATCTAGGGACTTTACA

Protein Synthesis

Proteins are made by joining small molecules called amino acids together.  This process is called protein synthesis and happens in small structures in the cytoplasm of all cells called ribosomes.  But for all eukaryote cells, this poses a big geographical problem.

The “information” in the gene is stored in a sequence of bases in a DNA molecule and is found in the nucleus.  DNA never leaves the nucleus because it is too important a molecule to be allowed into the reactive and unpredictable environment in the cytoplasm.  But there are no ribosomes in the nucleus and these are the structures in which proteins are actually made.  So a temporary intermediate molecule is needed to carry the “information” from the gene in the nucleus out into the cytoplasm where the ribosomes are found.  So the process of making a protein therefore has to exist as a two stage process.  The first stage is making the temporary intermediate molecule using the sequence of bases in the gene.  Then there is a second stage that happens in the cytoplasm in the ribosome and this involves joining the amino acids together to make the actual protein.

This idea was called the “central dogma of molecular biology” by Watson and Crick in their famous paper on the structure of DNA.

Transcription and Translation

There is quite a lot of jargon in this topic.

Transcription is the name for the process that happens in the nucleus in which a temporary intermediate molecule is made.  This temporary “information-containing” molecule is a form of RNA called messenger RNA (or mRNA for short).  The mRNA travels out of the nucleus to a ribosome which is found in the cytoplasm.  Here a process called Translation occurs in which the the amino acids are joined together in the correct order to make the protein.

Look at this second diagram of the central dogma above.  It shows a double-stranded DNA molecule at the top with pairs of bases (either A-T or C-G) joined by hydrogen bonds.  The “information” in the molecule is found in the sequence of bases: on the top strand of the DNA this sequence is ATGATCTCGTAA.

You can see that transcription results in the formation of a molecule of mRNA.  (Remember that RNA is always a single stranded molecule and contains the base Uracil in place of the base Thymine)

So can you see that the sequence of bases in the mRNA is almost identical to the DNA strand above, but with the base T replaced by the base U.

mRNA sequence:  AUGAUCUCGUAA

This diagram shows us one final thing about how protein synthesis works.  Look now at the small section of protein (polypeptide) that is produced in translation.  You can see that this section of protein is made of three amino acids joined together:  methionine (Met), attached to isoleucine (Ile) attached to serine (Ser)

Each amino acid is coded for by a group of 3 adjacent bases on the mRNA molecule.  These triplets of bases are called Codons.

• AUG is a codon that codes for the amino acid Methionine
• AUC is a codon that codes for the amino acid Isoleucine
• UCG is a codon that codes for the amino acid Serine

(UAA is called a stop codon as it ends the translation process at the ribosome)

A codon is a triplet of adjacent bases on a mRNA molecule.  Each codon codes for a single amino acid that will be joined together to make the protein.

Check your understanding:

Can you explain the meaning of the following terms?  Write a 2 mark explanation of what each word means.

1. Gene
2. Ribosome
3. Transcription
4. Messenger RNA
5. Translation
6. Codon

I will put the answers into the next post called Protein Synthesis (part 2) which I promise I will write tomorrow…… That’s enough for now.