What does DNA do? – Grade 9 Understanding for IGCSE Biology 3.14 3.15
In my previous post, I explained the structure of the molecule DNA. DNA is a long polymer found in the nucleus of all eukaryotic cells. But understanding the structure of the molecule is not too difficult… At iGCSE level it is quite hard to understand what DNA does in the cell and why it is such an important molecule in Biology. This post is an attempt to explain this more complex idea. Here goes…..
DNA is a molecule that can store information
This is a tricky concept to understand. You learn that the genetic information in a cell is stored in the nucleus but what does this phrase actually mean? Well I think it makes sense if you start to think of DNA is being a language. Consider the English language for a minute. How is information stored in this language? Well if you see the word CAT in English, you learn that these three letters in this order with a space either side conveys a meaning. The meaning is a small domesticated mammal of the family Felidae famous for their selfish temperament and willingness to kill huge numbers of wild song birds and rodents.

So a sequence of letters in English can form a word that has a distinct meaning.
Well there are sequences of letters in a DNA molecule too. The molecule is made up of two long chains of nucleotides joined together. There are four different nucleotides in DNA that differ in the base they contain – either Adenine (A), Thymine (T), Cytosine (C) or Guanine (G). So you could represent one half of the DNA molecule by a sequence of letters, like this: AGGCTACCCGTTATGCGTATC
(Remember that the opposite strand of a DNA molecule will always have complementary bases in the same sequence: in this case TCCGATGGGCAATACGCATAG)
The information in a DNA molecule is found by reading along one strand of the double helix. The sequence of bases as you read along the molecule can convey information in the same way as sequences of letters in English convey information.
Differences between English language and the language of DNA:
- English language has 26 letters, DNA has just four
- Words in English can have different lengths, in DNA all words are just three letters long.
There are others but lets leave it at that just for the moment…..
You might like to think how many words are possible in a language made up of 4 letters with each word being three letters long.
What information is stored in DNA?
DNA contains the information needed to build proteins. Proteins are a different kind of biological polymer made up of long chains of amino acids. There are 20 different kinds of amino acid that can be joined together to make a protein and as proteins can be several hundred amino acid residues long, the mathematically confident among you will see that the potential number of different proteins is enormous.
This wide variety of different possible structures of proteins is what makes them such important molecules in cells. The different protein molecules will all have different shapes and this means they can do a wide variety of different tasks in the cell.
What do proteins do in cells?
- Enzymes (catalysing all metabolic reactions)
- Transport Proteins (e.g for active transport)
- Structural Proteins (e.g. the proteins that make up the spindle in cell division)
- Contractile Proteins (essential in muscle cells)
- etc. etc. etc.
What information does the cell need to make a protein? Well it only really needs to know what sequence to join together the amino acids in to make up a protein. And this is what DNA does… The sequence of bases in the DNA as you read along one strand is a code that tells the cell the sequence of amino acids to join together to make a protein.
Each word in DNA is a called a codon and is three bases long. You should have calculated earlier that there are 64 codons (words) in the language of DNA. Don’t worry about the details of this table, but here is a picture that shows the 64 codons in DAN and the amino acid they code for: Phe, Leu, Val etc. are abbreviations of the names of amino acids.
So if CAT in English means a small furry mouse killer, CAT in the language of DNA means join the amino acid Histidine at this point in the growing protein chain.
DNA has another trick up its sleeve (it really is a special molecule……)
As well as being a brilliant coding molecule for storing information (see above) DNA is also a self-replicating molecule. This means that it can make a copy of itself very easily. You don’t need to worry how DNA moelcules are copied but you can probably see how it is done. Indeed Watson and Crick worked it out once they understood the double helix structure of the molecule…..
If you can “unzip” the DNA molecule by breaking the hydrogen bonds that hold the base pairs together, each strand can be used as a template for building a new complementary molecule. (Do you understand what complementary means in this context? If not, look it up! It is nothing to do with being nice to each other…..)




How does the DNA know how to instruct the cell to build proteins?where does that information come from?
Thanks for your question Eli – it is a good one and can be answered in lots of ways….
The first thing to say is that DNA itself doesn’t know how to do anything: it is just a chemical. A remarkable chemical but just a collection of atoms bonded together into the famous double helix.
Perhaps you are now thinking about how this complex molecule came into existence? Why is there DNA in the first place? Well the most likely answer to this is that DNA is a product of natural selection. DNA was definitely not the first “coding” molecule found in living cells, and it did not spring into existence in a one step creation process. Instead it will have been refined through a long series of small changes, each change a random event but crucially each of these events making it a slightly better self-replicating and coding molecule. There was probably a stage in early life on earth where there were many varied coding molecules in operation in simple cells, all storing information in some way and being passed from generation to generation. It just happens that all current life on earth is descended from a cell with DNA as the information store.
The final thing to say is that the process of using DNA as the source of information to build specific proteins requires a great deal of complexity. There are other nucleic acids required, many different enzymes and a collection of small molecules called transcription factors that bind to the DNA and switch on and off certain genes. This knowledge has been built up through billions of years of trial and error with natural selection acting as the mechanism to ensure only the most advantageous mechanisms persist. There is thus a great deal of information needed to make this process work.
Life is complex but that is what makes Biology such a fascinating and rewarding subject to discover.
What does each chromosome do?
Each chromosome will contain a certain number of genes and these genes will code for different proteins. So there isn’t a short answer to what does each chromosome do? If you know what genes are found on what chromosome, then you could build a chromosomal map showing which protein are coded for on each chromosome.
How far back is DNA is universal? Have we found any organism that does not have the same four letters in their codons?
All living organisms have the same four letters in their DNA. Now how DNA arose is a great “chicken and egg” problem…. It certainly wasn’t the first self-replicating and coding molecule on earth as it is far too complex to have arisen by chance.
Thank you – keep reading
Very interesting blog , possibly an area that I would like to look into deeper in the future.